graphein Download- graphein 소스 코드 다운로드

graphein

파이썬

v1.7.7

다운로드

문서 | 종이 | 튜토리얼 | 설치

단백질 및 대화식 그래프 라이브러리

이 패키지는 단백질 및 RNA 구조의 기하학적 표현, 생물학적 상호 작용 네트워크를 생성하는 기능을 제공합니다. 우리는 표준 Pydata 형식과 호환성을 제공하고 인기있는 딥 러닝 라이브러리에서 사용하기 쉽도록 설계된 그래프 객체를 제공합니다.

새로운 것은 무엇입니까?


1.7.0	접근 데이터 세트
1.7.0	PDB에서 데이터 세트 생성
1.6.0	단백질 텐서 모듈
1.5.0	Alphafold2의 단백질 그래프 생성!
1.5.0	도트 브래킷 표기법의 RNA 그래프 구성
1.4.0	분자 그래프 구성
1.3.0	Pytorch 기하학을위한 기성적인 데이터 로더
1.2.0	단백질 그래프에서 서브 그래프 추출
1.2.0	단백질 그래프 분석
1.2.0	그래 진 클리
1.2.0	단백질 그래프 시각화!
1.1.0	단백질 - 단백질 상호 작용 네트워크 지원 및 구조적 상호 작용 (Alphafold2 사용!)
1.0.0	대규모 유연성을위한 높고 저수준 API- 자신만의 맞춤형 워크 플로를 만듭니다!

예제 사용

Graphein은 프로그래밍 방식 API와 그래프 구성을위한 명령 줄 인터페이스를 제공합니다.

클리

Graphein 구성은 Commandline에서 프로세스 그래프를 배치하기 위해 .yaml 파일로 지정할 수 있습니다.

문서

graphein -c config.yaml -p path/to/pdbs -o path/to/output

단백질 그래프 생성


튜토리얼 (잔여 레벨)	튜토리얼 (Atomic)	문서

 from graphein . protein . config import ProteinGraphConfig
from graphein . protein . graphs import construct_graph

config = ProteinGraphConfig ()
g = construct_graph ( config = config , pdb_code = "3eiy" )

Alphafold 단백질 구조 데이터베이스에서 단백질 그래프 만들기


지도 시간	문서

 from graphein . protein . config import ProteinGraphConfig
from graphein . protein . graphs import construct_graph
from graphein . protein . utils import download_alphafold_structure

config = ProteinGraphConfig ()
fp = download_alphafold_structure ( "Q5VSL9" , aligned_score = False )
g = construct_graph ( config = config , path = fp )

단백질 메쉬 생성


지도 시간	문서

 from graphein . protein . config import ProteinMeshConfig
from graphein . protein . meshes import create_mesh

verts , faces , aux = create_mesh ( pdb_code = "3eiy" , config = config )

분자 그래프 생성

Graphein은 .sdf , .mol2 및 .pdb 파일뿐만 아니라 Smiles Strings에서 분자 그래프를 만들 수 있습니다.


지도 시간	문서

 from graphein . molecule . config import MoleculeGraphConfig
from graphein . molecule . graphs import construct_graph

g = create_graph ( smiles = "CC(=O)OC1=CC=CC=C1C(=O)O" , config = config )

RNA 그래프 생성


지도 시간	문서

 from graphein . rna . graphs import construct_rna_graph
# Build the graph from a dotbracket & optional sequence
rna = construct_rna_graph ( dotbracket = '..(((((..(((...)))..)))))...' ,
                          sequence = 'UUGGAGUACACAACCUGUACACUCUUUC' )

단백질-단백질 상호 작용 그래프 생성


지도 시간	문서

 from graphein . ppi . config import PPIGraphConfig
from graphein . ppi . graphs import compute_ppi_graph
from graphein . ppi . edges import add_string_edges , add_biogrid_edges

config = PPIGraphConfig ()
protein_list = [ "CDC42" , "CDK1" , "KIF23" , "PLK1" , "RAC2" , "RACGAP1" , "RHOA" , "RHOB" ]

g = compute_ppi_graph ( config = config ,
                      protein_list = protein_list ,
                      edge_construction_funcs = [ add_string_edges , add_biogrid_edges ]
                     )

유전자 조절 네트워크 그래프 생성


지도 시간	문서

 from graphein . grn . config import GRNGraphConfig
from graphein . grn . graphs import compute_grn_graph
from graphein . grn . edges import add_regnetwork_edges , add_trrust_edges

config = GRNGraphConfig ()
gene_list = [ "AATF" , "MYC" , "USF1" , "SP1" , "TP53" , "DUSP1" ]

g = compute_grn_graph (
    gene_list = gene_list ,
    edge_construction_funcs = [
        partial ( add_trrust_edges , trrust_filtering_funcs = config . trrust_config . filtering_functions ),
        partial ( add_regnetwork_edges , regnetwork_filtering_funcs = config . regnetwork_config . filtering_functions ),
    ],
)

설치

씨

가장 간단한 설치는 PIP를 통해입니다. NB 이것은 데이터 형식으로 변환하고 Pytorch 3D와의 단백질 구조 메쉬를 생성하는 데 필요한 ML/DL 라이브러리를 설치하지 않습니다. 자세한 내용

pip install graphein # For base install
pip install graphein[extras] # For additional featurisation dependencies
pip install graphein[dev] # For dev dependencies
pip install graphein[all] # To get the lot

그러나 PYPI를 통해 사용할 수없는 여러 (선택 사항) 유틸리티 (DSSP, Pymol, GetContacts)가 있습니다.

 conda install -c salilab dssp # Required for computing secondary structural features
conda install -c schrodinger pymol # Required for PyMol visualisations & mesh generation

# GetContacts - used as an alternative way to compute intramolecular interactions
conda install -c conda-forge vmd-python
git clone https://github.com/getcontacts/getcontacts

# Add folder to PATH
echo "export PATH=$PATH:`pwd`/getcontacts" >> ~/.bashrc
source ~/.bashrc
To test the installation, run:

cd getcontacts/example/5xnd
get_dynamic_contacts.py --topology 5xnd_topology.pdb 
                        --trajectory 5xnd_trajectory.dcd 
                        --itypes hb 
                        --output 5xnd_hbonds.tsv

콘다 환경

DEV 환경에는 그래프 핀에 통합 된 각 딥 러닝 라이브러리에 대한 GPU 빌드 (CUDA 11.1)가 포함됩니다.

git clone https://www.github.com/a-r-j/graphein
cd graphein
conda env create -f environment-dev.yml
pip install -e .

가벼운 설치는 다음과 같이 수행 할 수 있습니다.

git clone https://www.github.com/a-r-j/graphein
cd graphein
conda env create -f environment.yml
pip install -e .

dockerfile

우리는 CPU ( docker-compose.cpu.yml )와 GPU 사용 ( docker-compose.yml )에 대한 두 개의 docker-compose 파일을 로컬로 제공합니다. GPU 사용을 위해 NVIDIA 컨테이너 툴킷이 설치되어 있는지 확인하십시오. 컨테이너에 들어간 후 로컬 장착 볼륨을 설치해야합니다 ( pip install -e . ). 이것은 또한 DEV 환경을 로컬로 설정합니다.

(GPU) 실행을 빌드하려면 :

 docker-compose up -d --build # start the container
docker-compose down # stop the container

그래프 핀 인용

작업에 유용한 경우 Graphein을 인용하는 것을 고려하십시오.

 @inproceedings { jamasb2022graphein ,
  title = { Graphein - a Python Library for Geometric Deep Learning and Network Analysis on Biomolecular Structures and Interaction Networks } ,
  author = { Arian Rokkum Jamasb and Ramon Vi{~n}as Torn{'e} and Eric J Ma and Yuanqi Du and Charles Harris and Kexin Huang and Dominic Hall and Pietro Lio and Tom Leon Blundell } ,
  booktitle = { Advances in Neural Information Processing Systems } ,
  editor = { Alice H. Oh and Alekh Agarwal and Danielle Belgrave and Kyunghyun Cho } ,
  year = { 2022 } ,
  url = { https://openreview.net/forum?id=9xRZlV6GfOX }
}