الصفحة الرئيسية>المتعلقة بالبرمجة>بايثون
تنزيل



الوثائق | ورقة | دروس | تثبيت

مكتبة الرسم البياني للبروتين والتفاعل

توفر هذه الحزمة وظيفة لإنتاج تمثيل هندسي لهياكل البروتين و RNA ، وشبكات التفاعل البيولوجي. نحن نقدم التوافق مع تنسيقات Pydata القياسية ، وكذلك كائنات الرسم البياني المصممة لسهولة الاستخدام مع مكتبات التعلم العميق الشهيرة.

ما الجديد؟

1.7.0 مجموعات بيانات FoldComp
1.7.0 إنشاء مجموعات بيانات من PDB
1.6.0 وحدة موتر البروتين
1.5.0 بروتين الرسم البياني إنشاء من alphafold2!
1.5.0 RNA Graph Construction من تدوين Dotbracket
1.4.0 بناء الرسوم البيانية الجزيئية
1.3.0 dataloaders جاهزة للذهاب ل pytorch الهندسة
1.2.0 استخراج الخراطيم الفرعية من الرسوم البيانية للبروتين
1.2.0 تحليلات الرسم البياني للبروتين
1.2.0 جرامين كلي
1.2.0 بروتين الرسم البياني التصور!
1.1.0 البروتين - دعم شبكة التفاعل البروتين والتفاعلات الهيكلية (باستخدام alphafold2!)
1.0.0 واجهة برمجة تطبيقات عالية ومنخفضة المستوى للمرونة الهائلة - قم بإنشاء مهام سير العمل الخاصة بك!

مثال الاستخدام

يوفر Graphein كلاً من واجهة برمجية برمجية وواجهة سطر الأوامر لإنشاء الرسوم البيانية.

CLI

يمكن تحديد تكوينات الجرافين كملفات .yaml لتكوين الرسوم البيانية للعملية من سطر الأوامر.

مستندات 

graphein -c config.yaml -p path/to/pdbs -o path/to/output

إنشاء رسم بياني للبروتين

البرنامج التعليمي (مستوى البقايا) البرنامج التعليمي (ذري) مستندات 
 from graphein . protein . config import ProteinGraphConfig
from graphein . protein . graphs import construct_graph

config = ProteinGraphConfig ()
g = construct_graph ( config = config , pdb_code = "3eiy" )

إنشاء رسم بياني للبروتين من قاعدة بيانات بنية البروتين alphafold

درس تعليمي مستندات 
 from graphein . protein . config import ProteinGraphConfig
from graphein . protein . graphs import construct_graph
from graphein . protein . utils import download_alphafold_structure

config = ProteinGraphConfig ()
fp = download_alphafold_structure ( "Q5VSL9" , aligned_score = False )
g = construct_graph ( config = config , path = fp )

إنشاء شبكة بروتين

درس تعليمي مستندات 
 from graphein . protein . config import ProteinMeshConfig
from graphein . protein . meshes import create_mesh

verts , faces , aux = create_mesh ( pdb_code = "3eiy" , config = config )

إنشاء الرسوم البيانية الجزيئية

يمكن لـ Graphein إنشاء الرسوم البيانية الجزيئية من سلاسل الابتسامات بالإضافة إلى ملفات .sdf و .mol2 و .pdb

درس تعليمي مستندات 
 from graphein . molecule . config import MoleculeGraphConfig
from graphein . molecule . graphs import construct_graph

g = create_graph ( smiles = "CC(=O)OC1=CC=CC=C1C(=O)O" , config = config )

إنشاء رسم بياني RNA

درس تعليمي مستندات 
 from graphein . rna . graphs import construct_rna_graph
# Build the graph from a dotbracket & optional sequence
rna = construct_rna_graph ( dotbracket = '..(((((..(((...)))..)))))...' ,
                          sequence = 'UUGGAGUACACAACCUGUACACUCUUUC' )

إنشاء رسم بياني تفاعل بروتين البروتين

درس تعليمي مستندات 
 from graphein . ppi . config import PPIGraphConfig
from graphein . ppi . graphs import compute_ppi_graph
from graphein . ppi . edges import add_string_edges , add_biogrid_edges

config = PPIGraphConfig ()
protein_list = [ "CDC42" , "CDK1" , "KIF23" , "PLK1" , "RAC2" , "RACGAP1" , "RHOA" , "RHOB" ]

g = compute_ppi_graph ( config = config ,
                      protein_list = protein_list ,
                      edge_construction_funcs = [ add_string_edges , add_biogrid_edges ]
                     )

إنشاء رسم بياني لتنظيم الجينات

درس تعليمي مستندات 
 from graphein . grn . config import GRNGraphConfig
from graphein . grn . graphs import compute_grn_graph
from graphein . grn . edges import add_regnetwork_edges , add_trrust_edges

config = GRNGraphConfig ()
gene_list = [ "AATF" , "MYC" , "USF1" , "SP1" , "TP53" , "DUSP1" ]

g = compute_grn_graph (
    gene_list = gene_list ,
    edge_construction_funcs = [
        partial ( add_trrust_edges , trrust_filtering_funcs = config . trrust_config . filtering_functions ),
        partial ( add_regnetwork_edges , regnetwork_filtering_funcs = config . regnetwork_config . filtering_functions ),
    ],
)

تثبيت

pip

أبسط تثبيت هو عبر PIP. NB هذا لا يثبت مكتبات ML/DL التي مطلوبة للتحويل إلى تنسيقات البيانات الخاصة بهم ولتوليد شبكات بنية البروتين مع Pytorch 3D. مزيد من التفاصيل 

pip install graphein # For base install
pip install graphein[extras] # For additional featurisation dependencies
pip install graphein[dev] # For dev dependencies
pip install graphein[all] # To get the lot

ومع ذلك ، هناك عدد من الأدوات المساعدة (الاختيارية) (DSSP ، pymol ، getContacts) غير متوفرة عبر PYPI: 

 conda install -c salilab dssp # Required for computing secondary structural features
conda install -c schrodinger pymol # Required for PyMol visualisations & mesh generation

# GetContacts - used as an alternative way to compute intramolecular interactions
conda install -c conda-forge vmd-python
git clone https://github.com/getcontacts/getcontacts

# Add folder to PATH
echo "export PATH=$PATH:`pwd`/getcontacts" >> ~/.bashrc
source ~/.bashrc
To test the installation, run:

cd getcontacts/example/5xnd
get_dynamic_contacts.py --topology 5xnd_topology.pdb 
                        --trajectory 5xnd_trajectory.dcd 
                        --itypes hb 
                        --output 5xnd_hbonds.tsv

بيئة كوندا

تشتمل بيئة DEV على إنشاء GPU (CUDA 11.1) لكل من مكتبات التعلم العميقة المدمجة في الجرافين. 

git clone https://www.github.com/a-r-j/graphein
cd graphein
conda env create -f environment-dev.yml
pip install -e .

يمكن تنفيذ تثبيت أخف مع: 

git clone https://www.github.com/a-r-j/graphein
cd graphein
conda env create -f environment.yml
pip install -e .

Dockerfile

نحن نقدم ملفين docker-compose ل CPU ( docker-compose.cpu.yml ) واستخدام GPU ( docker-compose.yml ) محليًا. لاستخدام GPU ، يرجى التأكد من تثبيت مجموعة أدوات حاوية NVIDIA. تأكد من تثبيت وحدة التخزين المركبة محليًا بعد إدخال الحاوية ( pip install -e . ). سيؤدي هذا أيضًا إلى إعداد بيئة DEV محليًا.

لبناء (GPU) تشغيل: 

 docker-compose up -d --build # start the container
docker-compose down # stop the container

نقلا عن جرامين

يرجى النظر في ذكر الجرافين إذا كان يثبت مفيدًا في عملك. 

 @inproceedings { jamasb2022graphein ,
  title = { Graphein - a Python Library for Geometric Deep Learning and Network Analysis on Biomolecular Structures and Interaction Networks } ,
  author = { Arian Rokkum Jamasb and Ramon Vi{~n}as Torn{'e} and Eric J Ma and Yuanqi Du and Charles Harris and Kexin Huang and Dominic Hall and Pietro Lio and Tom Leon Blundell } ,
  booktitle = { Advances in Neural Information Processing Systems } ,
  editor = { Alice H. Oh and Alekh Agarwal and Danielle Belgrave and Kyunghyun Cho } ,
  year = { 2022 } ,
  url = { https://openreview.net/forum?id=9xRZlV6GfOX }
}
يوسع
معلومات إضافية
تطبيقات ذات صلة
نوصي لك
أخبار ذات صلة الكل