graphein

Dokumentation | Papier | Tutorials | Installation

Protein & Interactomic Graph Library

Dieses Paket bietet Funktionen für die Erzeugung geometrischer Darstellungen von Protein- und RNA -Strukturen sowie biologische Interaktionsnetzwerke. Wir bieten Kompatibilität mit Standard -Pydata -Formaten sowie Grafikobjekte, die für die einfache Verwendung mit beliebten Deep -Learning -Bibliotheken ausgelegt sind.

Was ist neu?

1.7.0	Faltendatensätze
1.7.0	Erstellen von Datensätzen aus der PDB
1.6.0	Protein -Tensor -Modul
1.5.0	Proteingraphenerstellung von Alphafold2!
1.5.0	RNA -Diagrammkonstruktion aus Dotbracket -Notation
1.4.0	Konstruktion molekularer Graphen
1.3.0	Bereits-Go-Dataloader für geometrische Pytorch
1.2.0	Extrahieren von Subgraphen aus Proteingraphen
1.2.0	Proteingrafikanalytik
1.2.0	Graphein Cli
1.2.0	Proteingrafikvisualisierung!
1.1.0	Protein - Protein -Interaktionsnetzwerkunterstützung und strukturelle Interaktomik (mit Alphafold2!)
1.0.0	Hohe und niedrige API für massive Flexibilität - Erstellen Sie Ihre eigenen maßgeschneiderten Workflows!

Beispiel Verwendung

Graphein bietet sowohl eine programmatische API als auch eine Befehlszeilenschnittstelle zum Konstruktion von Graphen.

Cli

Graphein -Konfigurationen können als .yaml -Dateien angegeben werden, um Prozessgraphen aus der Befehlszeile zu stapeln.

Dokumente

graphein -c config.yaml -p path/to/pdbs -o path/to/output

Erstellen eines Proteindiagramms

Tutorial (Rückstandsebene)	Tutorial (Atomic)	Dokumente

 from graphein . protein . config import ProteinGraphConfig
from graphein . protein . graphs import construct_graph

config = ProteinGraphConfig ()
g = construct_graph ( config = config , pdb_code = "3eiy" )

Erstellen eines Proteindiagramms aus der Datenbank der Alphafold -Proteinstruktur

Tutorial	Dokumente

 from graphein . protein . config import ProteinGraphConfig
from graphein . protein . graphs import construct_graph
from graphein . protein . utils import download_alphafold_structure

config = ProteinGraphConfig ()
fp = download_alphafold_structure ( "Q5VSL9" , aligned_score = False )
g = construct_graph ( config = config , path = fp )

Erstellen eines Proteinnetzes

Tutorial	Dokumente

 from graphein . protein . config import ProteinMeshConfig
from graphein . protein . meshes import create_mesh

verts , faces , aux = create_mesh ( pdb_code = "3eiy" , config = config )

Erstellen molekularer Graphen

Graphein kann molekulare Diagramme aus lächelnden Saiten sowie .sdf , .mol2 und .pdb -Dateien erstellen

Tutorial	Dokumente

 from graphein . molecule . config import MoleculeGraphConfig
from graphein . molecule . graphs import construct_graph

g = create_graph ( smiles = "CC(=O)OC1=CC=CC=C1C(=O)O" , config = config )

Erstellen einer RNA -Grafik

Tutorial	Dokumente

 from graphein . rna . graphs import construct_rna_graph
# Build the graph from a dotbracket & optional sequence
rna = construct_rna_graph ( dotbracket = '..(((((..(((...)))..)))))...' ,
                          sequence = 'UUGGAGUACACAACCUGUACACUCUUUC' )

Erstellen eines Protein-Protein-Interaktionsdiagramms

Tutorial	Dokumente

 from graphein . ppi . config import PPIGraphConfig
from graphein . ppi . graphs import compute_ppi_graph
from graphein . ppi . edges import add_string_edges , add_biogrid_edges

config = PPIGraphConfig ()
protein_list = [ "CDC42" , "CDK1" , "KIF23" , "PLK1" , "RAC2" , "RACGAP1" , "RHOA" , "RHOB" ]

g = compute_ppi_graph ( config = config ,
                      protein_list = protein_list ,
                      edge_construction_funcs = [ add_string_edges , add_biogrid_edges ]
                     )

Erstellen eines gener regulatorischen Netzwerkdiagramms

Tutorial	Dokumente

 from graphein . grn . config import GRNGraphConfig
from graphein . grn . graphs import compute_grn_graph
from graphein . grn . edges import add_regnetwork_edges , add_trrust_edges

config = GRNGraphConfig ()
gene_list = [ "AATF" , "MYC" , "USF1" , "SP1" , "TP53" , "DUSP1" ]

g = compute_grn_graph (
    gene_list = gene_list ,
    edge_construction_funcs = [
        partial ( add_trrust_edges , trrust_filtering_funcs = config . trrust_config . filtering_functions ),
        partial ( add_regnetwork_edges , regnetwork_filtering_funcs = config . regnetwork_config . filtering_functions ),
    ],
)

Installation

Pip

Die einfachste Installation ist über PIP. NB Dies installiert keine ML/DL -Bibliotheken, die für die Umwandlung in ihre Datenformate und zur Erzeugung von Proteinstrukturnetzen mit Pytorch 3D erforderlich sind. Weitere Details

pip install graphein # For base install
pip install graphein[extras] # For additional featurisation dependencies
pip install graphein[dev] # For dev dependencies
pip install graphein[all] # To get the lot

Es gibt jedoch eine Reihe von (optionalen) Dienstprogrammen (DSSP, Pymol, GetContacts), die nicht über PYPI verfügbar sind:

 conda install -c salilab dssp # Required for computing secondary structural features
conda install -c schrodinger pymol # Required for PyMol visualisations & mesh generation

# GetContacts - used as an alternative way to compute intramolecular interactions
conda install -c conda-forge vmd-python
git clone https://github.com/getcontacts/getcontacts

# Add folder to PATH
echo "export PATH=$PATH:`pwd`/getcontacts" >> ~/.bashrc
source ~/.bashrc
To test the installation, run:

cd getcontacts/example/5xnd
get_dynamic_contacts.py --topology 5xnd_topology.pdb 
                        --trajectory 5xnd_trajectory.dcd 
                        --itypes hb 
                        --output 5xnd_hbonds.tsv

Conda -Umgebung

Die Entwicklerumgebung umfasst GPU -Builds (CUDA 11.1) für jede der in Graphein integrierten Deep -Learning -Bibliotheken.

git clone https://www.github.com/a-r-j/graphein
cd graphein
conda env create -f environment-dev.yml
pip install -e .

Eine leichtere Installation kann mit:

git clone https://www.github.com/a-r-j/graphein
cd graphein
conda env create -f environment.yml
pip install -e .

Dockerfile

Wir stellen zwei docker-compose Dateien für CPU ( docker-compose.cpu.yml ) und GPU-Nutzung ( docker-compose.yml ) vor. Für die GPU -Nutzung stellen Sie bitte sicher, dass Sie NVIDIA Container Toolkit installiert haben. Stellen Sie sicher, dass Sie das lokal montierte Volumen nach Eingabe des Containers ( pip install -e . ) installieren. Dadurch wird auch die Entwicklerumgebung lokal eingerichtet.

Zum Bau (GPU) laufen:

 docker-compose up -d --build # start the container
docker-compose down # stop the container

Zitieren von Graphein

Bitte erwägen Sie, Graphein zu zitieren, wenn es sich in Ihrer Arbeit als nützlich erweist.

 @inproceedings { jamasb2022graphein ,
  title = { Graphein - a Python Library for Geometric Deep Learning and Network Analysis on Biomolecular Structures and Interaction Networks } ,
  author = { Arian Rokkum Jamasb and Ramon Vi{~n}as Torn{'e} and Eric J Ma and Yuanqi Du and Charles Harris and Kexin Huang and Dominic Hall and Pietro Lio and Tom Leon Blundell } ,
  booktitle = { Advances in Neural Information Processing Systems } ,
  editor = { Alice H. Oh and Alekh Agarwal and Danielle Belgrave and Kyunghyun Cho } ,
  year = { 2022 } ,
  url = { https://openreview.net/forum?id=9xRZlV6GfOX }
}